Ethical statementThis study uses PerSCs isolated from the adipose tissue of healthy consenting patients undergoing cosmetic lipectomy procedures or from patients undergoing breast reconstruction procedures using deep inferior epigastric perforators (DIEP) with prior written consent; as such, all donors from this procedure were female. Ethical approval for the collection of adipose tissue and subsequent research was granted by the South-East Scotland Research Ethics Committee 3 (SESREC03, reference no. 10/S1103/ 45). Human CD34+ve cells were either purchased from CalTag Medsystems or STEMCELL Technologies, or isolated from the bone marrow aspirates of patients undergoing joint replacement surgery with prior written consent. The permission to use the residual tissues was given by the Greater Glasgow and Clyde NHS Biorepository. CD34+ve cells used in this study are from patients aged 20-80 years old and are a mixture of male and female donors. 50/50 male/female CD34+ve cells were purchased. Both male and female cells were used in all experiments. In line with ethics and patient confidentiality, details of age and sex were blinded to the researchers carrying out tissue isolations and subsequent work. Due to limited donor availability via both procedures, no specific age group or sex was used in this study. All NRG-3GS mice were 8 -10 wk old males and were housed at the Beatson Research Unit (University of Glasgow, UK). Experimental protocols for working with animals were approved by the local AWERB committee and the national Home Office (PD6C67A47).Preparation of materials and ECM interfacesPolymer sheets were obtained by radical polymerisation of a solution of either MA (methyl acrylate) or EA (ethyl acrylate) (Sigma-Aldrich, UK), using 1 and 0.35 weight percent benzoin (98% pure; Scharlau) as the photoinitiator. Polymerisation carried out up to limiting conversion. After polymerisation, low molecular mass substances extracted by drying under vacuum to constant weight. PMA and PEA were dissolved in toluene at a concentration of 6% or 9% and 2.5% or 12% dependent on batch. Spin casting was performed on glass coverslips at 2000 rpm for 30 s. Samples dried under vacuum at 60 °C for 2 h, and sterilised under UV light for 30 min before use35. FN from human plasma (Sigma-Aldrich, F2006) was adsorbed from solutions of 20 µg/ml for 1 h a room temperature (RT) and then washed thrice with phosphate-buffered saline (PBS). For GF adsorption, BMP-2 (50 ng/ml; Sigma-Aldrich, H4791) in PBS was used for 2 h at RT. Finally, samples were rinsed in PBS to eliminate non-adsorbed protein.Atomic force microscopyFN was prepared in PBS (20 µg/ml), and a 200 µl droplet placed on surface of PEA and PMA-coated coverslips. The protein was adsorbed for 10 min, and remaining liquid removed from the surface. Surfaces were then washed twice in PBS, once with deionized, water and then dried under a stream of nitrogen before imaging. A JPK Nanowizard 4 (JPK Instruments) was used for imaging in tapping mode, using antimony-doped Si cantilevers with a nominal resonant frequency of 75 kHz (MPP-21 220, Bruker). The phase signal was set to 0 at a frequency 5–10% lower than the resonant frequency. Height and phase images were acquired from each scan, and the JPK data processing software version 5 was used for image analysis.FN adsorption assaysTo quantify amount of FN adsorbed onto PEA or PMA surfaces substrates were coated with 20 µg/ml FN/PBS solution for 1 h, aspirate was collected, and FN quantified using the Pierce™ BCA Protein Assay Kit (ThermoFisher, UK). Quantitative immunofluorescence assays were carried out using the LI-COR in-cell western™ platform. FN (20 µg/ml) was adsorbed as previously described, samples were washed with PBS, blocked with 1% milk protein in PBS, and incubated with primary antibodies for total FN (polyclonal rabbit, Sigma Aldrich), HFN7.1 (monoclonal mouse, Developmental Studies Hybridoma Bank, USA), and P5F3 (monoclonal mouse, Santa Cruz Biotechnology, sc-18827) for 2 h. Substrates were washed 5× 0.5% Tween20 in PBS (PBST), followed by incubation o/n at 4 °C with LI-COR secondary antibodies (IRDye 800CW/700CW anti-rabbit/mouse secondary antibody, LI-COR, UK). Samples were washed 5× with PBST, followed by a final wash in PBS and dried before imaging on LI-COR Sa Odyssey scanner.BMP-2 adsorptionFor quantification of BMP-2 adsorption, (50 ng/ml) BMP-2 solution was added to FN-coated polymers and after 2 h incubation solution was aspirated and collected in Protein LoBind Tubes (Eppendorf™). Enzyme-linked immunosorbent assays (ELISA) were then carried out as per manufacturer’s instructions (R&D Systems, BMP-2 DuoSet ELISA kit, DY355). Briefly, ELISA plates were coated with capture antibody overnight, then blocked for 1 h with BSA. Standards, original solution, original solution at 20× dilution, and sample aspirates were then added to the plate, and bound BMP-2 was detected with biotinylated anti-human BMP-2. Streptavidin-HRP was added to plates for 20 min in the dark, followed by substrate solution (tetramethylbenzidine and peroxide) for 20 min, the reaction was then stopped by adding stop solution. Absorbance measured at 450 nm with wavelength correction at 570 nm.PerSC isolationPerSCs were isolated from the adipose tissue of healthy adult donors undergoing cosmetic lipectomy procedures with prior written consent, or from patients undergoing breast reconstruction procedure, using DIEP, from adult donors. Incisions were made in the adipose tissue using a scalpel to divide the Scarpa’s fascial layer, then tissue was mechanically disrupted, combined with PBS and centrifuged at 445 × g for 10 mins at RT, causing phase separation. The 3 phases include the top phase (liquid fat/oil), central phase containing the tissue of interest (adipose tissue), and the bottom phase (blood/fluid). Middle layer was removed and mixed with equal volumes of PBS/2% (v/v) fetal bovine serum (FBS) and centrifuged at 445 × g for 10 mins. Supernatant was discarded and the remaining stromal vascular fraction (SVF) pellet, was enzymatically digested with type II-S collagenase 1 mg/ml in DMEM/0.5% (v/v) BSA for 45 mins at 37 °C. Samples were centrifuged and supernatant discarded (containing oil and adipocytes) and pellets resuspended and strained through 400 µm, 100 µm and 70 µm cell pluristrainers to remove undigested material. Red blood cell lysis buffer was added to eliminate erythroid cells and SVF pellet resuspended in Fluorescent Activated Cell Sorting (FACS) buffer. Cells sorted on CD146+ve/CD45−ve/CD34−ve/CD31−ve phenotype (anti-CD146 clone P1H12, BV711, 563186; anti-CD45 clone H130, V450, 560367; anti-CD34 clone 581, FITC, 555821; anti-CD31 clone WM59, PE-Cy7, 563651. All BD Biosciences), using BD FACSAria cell sorter (BD Biosciences). Immediately after sorting, cells were then cultured as previously described16. Briefly, cells were cultured in endothelial growth medium (EGM-2, Lonza) on 0.1% gelatin-coated plates in a humidified incubator with 5% CO2 at 37 °C until passage 1.PerSC cell culturePerSCs, after passage 1, were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM, Sigma-Aldrich) with 20% FBS (Thermo Fisher), 1% nonessential amino acids (Sigma-Aldrich), 1% 100 mM sodium pyruvate (Sigma-Aldrich) and an antibiotic mix consisting of 10 mg/ml penicillin/streptavidin (Sigma-Aldrich), 200 nM L-glutamate (Sigma-Aldrich), and 0.5% Fungizone (Thermo Fisher). Cells were incubated in a 5% humidified CO2 atmosphere at 37 °C. For cell culture on polymer substrates, cells were seeded at 1.5 × 103/cm2 on 13 mm coverslips in 24 well-plates and cultured in DMEM containing 2% with human AB serum (HS; Sigma Aldrich, H4522) in a 5% humidified CO2 atmosphere at 37 °C. Hypoxic culture carried out in hypoxic workstation (Ruskinn) at an oxygen tension of 1%, CO2 5% and 37 °C. Medium was exchanged every 3 days.CD34+ve cell isolationHuman CD34+ve cells were isolated from the bone marrow aspirates of patients undergoing joint replacement surgery. For isolation of CD34+ve cells, mononuclear cells were resuspended with FACS buffer and incubated with CD34+ve microbeads (Militenyi Biotec, #130-046-702) for 30 mins at 4 °C. Cell suspensions were transferred to LS Columns (Militenyl Biotec, #130-042-401) and passed through the magnetic Quadromacs Separation Unit (Militenyi Biotec, #130-090-976). Magnetically labelled CD34+ve cells were then collected, counted and cryopreserved.CD34+ve cell cultureCD34+ve cells from human BM were purchased from CalTag Medystems (experiments related to Fig. 7b–e) and STEMCELL Technologies or isolated from BM samples as above (Fig. 7f). CD34+ve cells were cultured in serum-free medium; Iscove’s Modified Dulbecco Medium (IMDM) containing 20% BIT 9500 serum substitute (STEMCELL Technologies), 1% 200 mM L-glutamine (Sigma-Aldrich), 1% 10 mg/ml penicillin/streptomycin (Invitrogen) supplemented with Flt3L (50 ng/ml), SCF (20 ng/ml) and TPO (25 ng/ml) (all recombinant human, Peprotech, 300-19, 300-07, 300-18) (100% medium). CD34+ve cells were thawed, counted, and rested overnight in 100% medium at a density of 0.5 × 106/ml, then recounted, suspended in 100% or 0% media, and seeded into niche models at a density of 5 × 104 cells/ml, with 0.5 ml added to each well of 24 well plate. For conditions containing gels, the HSCs were seeded on top of the gel. Control (100% media only) was seeded into 24 well plates. Seeded cells were then cultured for 5 days. At least 1 × 103 cells were transferred to an Eppendorf tube and phenotyped at day 0 using flow cytometry.Collagen gel preparation and rheological measurementCollagen type I gels were added to relevant (+gel) conditions after either 24 h (for short-term culture) or 72 h (for long-term culture). Rat tail collagen type I solution in 0.6% acetic acid (First Link, UK) was combined with human AB serum (HS; Sigma-Aldrich, H4522), 10× DMEM, 2% HS DMEM, adjusted to pH 8.2 using 0.1 M NaOH. 1 ml of solution was then added to 24 well-plates containing PEA coated 13 mm coverslips. The resulting gels were ~1 cm thick. Rheological measurements were carried out using an Anton Paar Physical MCR301 rheometer. A parallel plate geometry (25 mm diameter, sandblasted) and 1.0 mm gap were used to measure time sweeps. The dynamic modulus of the hydrogel was measured as a frequency function, with frequency sweeps carried out between 0.1–15 Hz to measure the dynamic shear of the modulus as a function of strain. Measurements were repeated 3 times on gels from 3 different batches. Storage moduli (Gˊ) values were extracted from the accompanying Kinexus software. The Young’s modulus was then determined by taking the Gˊ and multiplying by 3, assuming a Poisson’s ratio of 0.5 in accordance with Hooke’s law.ImmunocytochemistryPerSCs were cultured in niches for times indicated and fixed using 10% formaldehyde for 15 mins. For SCF and CXCL12 analysis, cells were cultured with 5 µg/ml brefeldin A (SigmaAldrich, B6542), for the final 24 h of culture before fixation. Cells were then permeabilized with 0.5% Triton-X for 5 mins and blocked using 0.5% BSA/PBS for 2 h at RT. Primary antibodies were then added in blocking buffer: anti-nestin [10C2] 1:200 (mouse monoclonal, Abcam, ab22035); anti-p(Th316)-nestin [a-4] at 1:200 (mouse monoclonal, Santa Cruz Biotechnology, sc-377538); anti-HIF1α [EP1215Y] 1:300 (rabbit monoclonal, Abcam, ab51608); anti-vimentin [SP20] 1:300 (rabbit monoclonal, Thermo Fischer, MA5-16409); anti-CXCL12 1:200 (monoclonal mouse, R & D Systems, MAB350); anti-SCF 1:200 (rabbit polyclonal, Abcam, ab64677). Cells were then washed 5 × 5 mins with PBST and biotinylated secondary antibodies (1:50; Vector Laboratories) were added in blocking buffer for 2 h at RT. Cells were again washed 3 × 5 mins in PBST and incubated with fluorescein isothiocyanate-conjugated streptavidin (1:50; Vector Laboratories) in blocking buffer for 30 mins at RT. Nuclei were stained using VECTASHIELD mountant with 5’,6-diamidino-2-phenylindole nuclear stain (DAPI; Vector Laboratories). Samples were then mounted onto glass slides and visualised using an Axiophot microscope or Evos Cell imaging system (Thermo Fischer) and analysed using ImageJ software (National Institute of Health). HIF1α nuclear co-localisation was analysed using a custom-developed pipeline on CellProfiler software (version 2.1.1). Images were background corrected and analysis normalised to cell number via DAPI/Hoescht staining, or individual cells measured, as stated in figure legends.Flow cytometryTo phenotype PerSCs and HSCs after culture, cells were harvested from niche systems using collagenase D (2.5 mg/mL in PBS; Sigma-Aldrich) and TripLE™ (Thermo Fisher). Cells were passed through a 70 µm filter, and stained on ice for 30 mins, using antibodies outlined in supplementary Tables 3 and 4 for PerSC and HSC markers, in flow cytometry buffer (PBS supplemented with 0.5% BSA and 0.5 mM EDTA). Cells were then washed twice with PBS and analysed using an BD FACSCanto ll (BD Biosciences). The BD FACSAria Cell sorter was used for CD34+ve sorting for LTC-IC and in vivo assays. The gating strategy is shown in Supplementary Figs. 5 and 13. Flow cytometry files were analysed using FlowJo software (version 10.5.3, FlowJo LLC, USA). Single-cell suspensions from in vivo experiments were prepared for phenotypic analysis by flow cytometry as described previously75. All antibodies for in vivo analysis are shown in supplementary Table 5. All samples were suspended in 100 µl FACS buffer prior to acquisition. Flow cytometry data were acquired using a FACSCantoII flow cytometer (BD Biosciences) using the FACS Diva software package and analysed using the FlowJo software package (Tree Star, Inc., Ashland, OR).RNA-seqSequencing libraries then prepared from total RNA using the Illumina TruSeq Stranded mRNA Sample Preparation Kit. Libraries were sequenced in 75 base, paired-end mode on the Illumina NextSeq 500 platform. Raw sequence reads were trimmed for contaminating sequence adaptors and poor-quality bases using the programme Cutadapt76. Bases with an average Phred score lower than 15 were trimmed. Reads that were trimmed to <54 bases were discarded. The quality of the reads was checked using the FastQC programme (http://www.bioinformatics.babraham.ac.uk/projects/fastqc/) before and after trimming. The reads were “pseudo aligned” to the transcriptome using the programme Kallisto77. The differential expression for the analysis groups was assessed using the Bioconductor package DESeq278. This was provided as a service by Glasgow Polyomics Facility. One hypoxic sample failed RNA quality control. Heatmaps in Fig. 3g, h were subsequently generated using Cluster 3.0 and Java Treeview 3.0 software, with average linkage clustering method. To assess expression of transcripts related to an immunomodulatory phenotype, the distribution of reads across genomic features was quantified using the R package Genomic Ranges from Bioconductor Version 3.065. Differentially expressed genes were identified using the R package edgeR from Bioconductor Version 3.066. For Fig. 4a–c and Supplementary Fig. 6, analyses were performed within the R statistical computing framework using packages from BioConductor. Feature counts were utilised to quantify reading counts. Human ENSEMBL gene ID to gene symbol conversion was performed in BioTools (https://www.biotools.fr). The DEseq2 BioConductor package was used for outlier detection, normalisation and differential gene expression analyses. Genes passing a threshold of Wald test p values and adjusted p value < 0.05 and a log2 fold change >1 were considered as differentially expressed. The names of differentially expressed genes along with their respective log2fold changes were inputted into PathfindR package. Gene Ontology (GO) enrichment was conducted with PathfindR. Only pathways with FDR ≤ 0.05 were considered as differentially enriched. The differentially expressed genes involved in every pathway were extracted and their z scored fold changes in expression were presented as heatmaps.VEGF ELISAPerSCs were cultures in niche systems and media supernatant was collected in Protein LoBind Tubes (Eppendorf™) at days 7 and 14 and stored at −20 °C. ELISA for VEGF was then carried out as per manufacturer’s instructions (R&D Systems, VEGF Quantikine ELISA kit, DVE00). Standards and media aspirate were added to the ELISA plate in duplicate. Absorbance measured at 450 nm with wavelength correction at 570 nm.Hypoxyprobe™ assayPerSCs were cultured in niche models for 6 days, medium was then changed to fresh medium containing 200 µM pimonidazole (Hypoxyprobe™, HP1-200kit), and cultured for a further 24 h. Cells were then fixed, permeabilized, and blocked as described for immunocytochemistry. Mouse monoclonal anti-pimonidazole (1:200; Hypoxyprobe™, HP1-200kit) was added in blocking buffer and incubated overnight at 4 °C. Cells were washed 3 × 5 mins in PBST and incubated with anti-mouse secondary (1:50, Texas Red; Vector Laboratories) for 2 h at RT. Cells were washed 3 × 5 mins in PBST and mounted onto glass slides with DAPI nuclei stain VECTASHIELD mountant (Vector Laboratories). Samples were visualised on Evos Cell imaging system (ThermoFisher) and analysed using ImageJ software (National Institute of Health).MetabolomicsWhole-cell metabolomic analysis was performed on cell lysates isolated from PerSCs cultured in niche systems for 7 or 14 days. Substrates were washed with ice-cold PBS, and cells lysed in extraction buffer (PBS/methanol/chloroform at 1:3:1 ratio) for 60 mins at 4 °C with constant agitation. Lysates were then transferred to cold Eppendorfs™ and spun at 13000 g at 4 °C for 5 mins to remove debris and stored at −80 °C. Cleared extracts were used for hydrophilic interaction LC/MS analysis (UltiMate 3000 RSLC, (ThermoFisher), with a 6 150 × 4.6 mm ZIC- pHILIC column running at 300 µl/min-1 and Orbitrap Exactive). A standard pipeline, consisting of XCMS (peak picking), MzMatch (filtering and grouping) and IDEOM (further filtering, post-processing and identification) was used to process the raw mass spectrometry data. Identified core metabolites were validated against a panel of unambiguous standards by mass and predicted retention time. Further, putative identifications were generated by mass and predicted retention times. Heatmaps of selected metabolites and PCA plots were generated using MetaboAnalyst software (version 4.0). This was provided as a service by Glasgow Polyomics Facility.
13C6-Glucose metabolomic tracingPerSCs were seeded onto PEA/FN/BMP-2 niche systems and allowed to grow for 72 h. Cells were then washed and media was changed to basal media comprising 25% normal glucose and 75% 13C6-Glucose (Cambridge Isotopes Ltd). Extraction performed in PBS/methanol/chloroform at 1:3:1 ratio, after 3 days incubation and prepared for LC-MS. The LC-MS platform consisted of an Accela 600 HPLC system combined with an Exactive (Orbitrap) mass spectrometer (ThermoFisher). Two complementary columns were used; the zwitterionic ZICpHILLIC column (150 mm × 4.6 mm; 3.5 µm, Merck) and the reversed phase ACE C18-AR column (150 mm × 4.6 mm; 3.5 µm Hichrom) and in both cases sample volume was 10 µl at a flow rate of 0.3 ml/min. Eluted samples were then analysed by mass spectrometry. Raw data from LC-MS of 13C-labelled extracts was processed to generate a combined PeakML file79. Further analysis using mzMatch-ISO in R80 generated a PDF file containing chromatograms used to check peak-shape and retention time, and a tab-delineated file detailing peak height for each isopotologue, which was used to calculate percentage labelling. Samples normalised to cell number. Total 13C6-Glucose incorporation was calculated by totalling incorporation excluding up to C2 to eliminate natural incorporation. This was provided as a service by Glasgow Polyomics Facility.siRNA NES silencing NESPerSCs were seeded into niche models in antibiotic free 2% HS DMEM, after 24 h media was changed to Opti-MEM™ (ThermoFisher) and siRNA transfection was carried out 24 h later. Pre-designed Silencer™ Select siRNA NES (ID: 21141), or Silencer™ Select negative control number 1 siRNA (both Thermo Fisher), was incubated at RT for 20 mins with Lipofectamine™ RNAiMAX (ThermoFisher) in Opti-MEM™ and added to PerSCs in niches. 6 h later, Opti-MEM™ +2% HS was added to control and −gel conditions. For +gel, media containing siRNA was collected and used to prepare collagen gels as described above. Once collagen had set, Opti-MEM™ +2% HS was added. Cells were then cultured for 72 h and either fixed for immunofluorescence analysis or cytotoxicity assays carried out.Cytotoxicity assayCells were cultured in niche models for time points indicated. Collagen gels were removed and 1 mM H2O2 added for the final 6 h of culture. Hoechst (33342) nuclear stain (ThermoFisher, R37605) and PI (Biolegend, 421301) viability stain was then added and imaged on EVOS M7000 imaging system using the on-stage incubator.LTC-IC assayLTC-IC assays were carried out on sorted CD45+ve/Lineage−ve/CD34+ve cells harvested after 5 days of culture in niche systems (supplementary Table 4). Engineered stromal fibroblast feeder layers were first established. M2-10B4 (overexpressing IL-3 and G-CSF) and Sl/Sl (overexpressing IL-3 and SCF) were passaged at ~90% confluence (cell lines gifted from StemCell Technologies). Cells were grown for 2 weeks prior to use in selection agents to select stromal cells expressing long-term cell maintenance factors (M2-10B4, 0.4 mg/ml G418 and 0.06 mg/ml Hygromycin B; Sl/Sl, 0.8 mg/ml G418 and 0.15 mg/ml Hygromycin B) G418 and Hygromycin B both StemCell Technologies (03812, 03812). Cells at ~80% confluence were irradiated with 8000 cGy, trypsinised. M2-10B4 and Sl/Sl were mixed at 1:1 ratio at a final concentration of 1.5 × 106/ml. Cells were then seeded into collagen coated 24 well plates (Thermo Fisher, A1142802) for 24 h before adding sorted cells. Cultures were then maintained for 6 weeks in MyeloCult™ (StemCell Technologies, 05150) supplemented with 1 × 10−6 M hydrocortisone (StemCell Technologies, 74142), with half media exchanges twice per week.CFU assayCells were harvested and resuspended in MethoCult™ (StemCell Technologies, 04435) from LTC-IC assays after 6 weeks. Two replicates were seeded for each condition in 35 mm dishes and incubated at 37 °C in 5% CO2 for 7 days. After 7 days total colonies were counted and phenotyped using a light microscope.Xeno-transplantationsNOD-RAG-γc−/− mice constitutively expressing human IL3, GMCSF and Steel factor (NRG-3GS81) were used as hosts (8–10 wk old; male) for transplantation, to establish the lineage potential of human HSCs derived from indicated culture conditions in vivo. Human BM CD34+ve cells were cultured in GS (n = 5 mice) or PEA +gel (n = 3 mice) niches as previously described and CD45+ve/Lineage−ve/CD34+ve cells harvested after 5 days of culture by FACS. Freshly thawed CD34+-enriched HSCs isolated from BM (StemCell Technologies) were used as a positive control for engraftment (n = 2 mice). NRG-3GS mice were sub-lethally irradiated with two doses of 1 Gy, 3 h apart. The irradiated mice were transplanted within 24 hr of the last dose with human HSCs via tail vein injection (200,000 cells/mouse). After six weeks, blood sampling (~20 μl) was performed every 2 weeks to track the progress of human cell engraftment by flow cytometry (hCD45-APC-Cy7 vs mCD45-PerCP), preparing the blood samples for flow cytometry using EasyLyse (Agilent Technologies) following the manufacturer’s instructions. After 12 wk, mice were sacrificed and BM, spleen and blood were collected for analyses. Spleens were weighed and cells extracted in FACS buffer (PBS/2% FBS). BM was recovered by crushing the ilia, femurs, and tibia of each mouse using a pestle and mortar in FACS buffer. The cells collected from the BM and spleen were filtered through 70 μm mesh and enriched for haemopoietic lineage cells by density centrifugation using Lympholyte-Mammal (VWR, Lutterworth, UK), centrifuging the cell suspension for 20 min at 625 × g at RT. Thereafter, the cells were washed in FACS buffer, centrifuged at 500 × g for 10 min at RT. Cells were counted using a haemocytometer and prepared for flow cytometry.CRISPRCD34+ve cells were thawed 24 h before electroporation and cultured in IMDM + BIT + 100% cytokine media without antibiotics. Ribonucleoprotein (RNP) complexes were prepared by mixing Cas9 (IDT) at 12 µM and AAVS1_A1 sgRNA (GTCACCAATCCTGTCCCTAG, Synthego) at 12 µM, in electroporation buffer R (ThermoFisher) with 2% glycerol61, and incubated for 15 min at RT immediately before electroporation. Electroporation was performed using the Neon™ transfection system, with 10 µl tips (ThermoFisher), as per manufacturers protocol. The optimal electroporation conditions for CD34+ve cells was 1700 V, 20 ms, one pulse. CD34+ve cells were resuspended in buffer R and mixed with assembled RNPs. Electroporated cells were resuspended in either 100% or 0% cytokine IMDM + BIT and 0.5 ml added into niche models at a density of 5 × 104 cells/ml. Cells were then cultured for 5 days, and harvested as previously described using collagenase D, with final resuspension into 30 µl of Quick Extract™ reagent (Lucigen). For mutagenesis analysis, Quick Extract samples were diluted 1:1 with fresh QuickExtract and heated to 65 °C for 6 mins, vortexed for 15 s, and heated to 98 °C for 2 mins. Genomic PCR was carried out using Herculase II Fusion DNA Polymerase (Agilent) (Forward primer: CCCCGTTCTCCTGTGGATTC, Reverse primer: ATCCTCTCTGGCTCCATCGT). PCR products were run on 1.2 % UltraPure™ Agarose (Invitrogen) gels, purified (QIAquickPCR Purification Kit, Qiagen), and Sanger Sequenced (Eurofins Genomics). Mutagenesis analysis was carried out by TIDE analysis82 (http://shinyapps.datacurators.nl/tide/) (Supplementary Fig. 5).Trilineage differentiation of PerSCsPerSCs at ≤passage 5 were cultured in differentiation medias for 4 weeks: osteogenic media—DMEM with 10% FBS, 0.1 µM dexamethasone (Sigma, D2915), 100 µM Ascorbate-2-phosphate (Sigma, A8960), 10 mM β-Glycerophosphate disodium salt hydrate (Sigma, G9422); Adipogenic media–DMEM with 10% FBS, 1 µM dexamethasone, 500 µM 3-isobutyl-1-methylxanthine (Sigma, I5879), 1.8 µM Insulin (Sigma, I9278), 100 µM indomethacin (Sigma, I7378); Chondrogenic media–100 nM dexamethasone, 100 nM Ascorbate-2-phosphate, 1% (v/v) insulin, transferrin, selenium (Thermo Fischer, 41400-045), 40 mg/mL L-proline, 10 ng/mL TGFβ3 (Peprotech, 100-36E). Cells were then fixed using 10% formaldehyde for 15 mins at RT. After washing with PBS, osteogenic fixed cells were stained with 2% (w/v) Alizarin Red solution (pH 4.1 to pH 4.3) for 15 min at room temperature. After staining, cells were washed in deionized water. For adipogenic staining, fixed cells were washed with distilled water three times, rinsed with 60% (v/v) isopropanol. Oil Red O solution was then added to the cells, and cells were incubated at room temperature for 15 min. Dye solution was removed, and cells were washed again with 60% (v/v) isopropanol, washed three times in distilled water. For chondrogenic staining, cells were fixed with 0.1 % glutaraldehyde in PBS for 20 min at RT. Rinsed 3× PBS, rinsed 1× with 1 % acetic acid solution for 10–15 s and stained with 0.1 % Safranin O solution (Merck) for 5 min. Cells were then washed 3× PBS. Cells were then imaged on an inverted microscope (Olympus, PA, USA) operated through Surveyor software (v.9.0.1.4, Objective Imaging, Cambridge, UK). Images were processed using ImageJ [v.1.50 g, National Institutes of Health (NIH), USA].Lactate assayPerSCs were cultured in niche systems in DMEM with 2% dialysed FBS (ThermoFisher, A3382001), cell media supernatant was aspirated at 7 and 14 days and stored at −20 °C. Lactate levels in supernatant were then measured using the Lactate-Glo™ assay (Promega, J5021) as per manufacturers protocol. Briefly, samples were diluted 1:100 and mixed 1:1 with Lactate Detection Reagent in 96-well plate and incubated for 1 h at RT. Luminescence was read using PHERAstar FSX microplate reader (BMG Labtech).In-cell western assay for LDHPerSCs were cultured in niches for 7 days then fixed using 10% formaldehyde for 15 min. The cells were then permeabilized with 0.5% Triton-X for 5 mins and blocked using 0.5% milk protein in 1× PBS. Anti-lactate dehydrogenase (LDH) [EP1566Y] (rabbit monoclonal, Abcam, ab52488) was added at 1:200 in 0.5% milk PBS and incubated at 4 °C overnight, followed by 5 washes in PBST. CellTag 700 stain (LI-COR, 926-41090) was used as the reference control, and was added with LI-COR anti-rabbit secondary antibody (926-32211), at 1:2000 in 0.5% milk PBST and incubated at RT on a shaker for 2 h, followed by 5× 5 min washes with PBST. The quantitative spectroscopic analysis was carried out using the LI-COR Odyssey Sa.Statistics and reproducibilityThree or more material replicates were used for independent experiments with different biological donors, unless otherwise indicated in the figure legends. For CD34 + HSC cells used for in vivo analysis, 10 donors were pooled. Were multiple replicates pooled, this was on a per-application basis, where larger amounts of materials are required for certain techniques. No statistical method was used to predetermine the sample size. Shapiro–Wilks normality tests were performed, and statistical analysis used to calculate P values was by one-way analysis of variance with Tukey’s or Bonferroni’s multiple comparison tests for normal and non-normal data, respectively. T tests used were indicated in figure legends. All statistical analysis was performed using GraphPad Prism 10 software. Refer to the Source Data file for the details on statistical analysis. One sample was removed from metabolomics analysis as it failed to produce readable peaks. One sample was removed from RNA-seq analysis due to insufficient RNA quality. Quality reports and peak intensity tables can be provided. The investigators were not blinded to allocation during experiments and outcome assessment; except for in vivo experiments, where the investigator was blinded upon the xenotransplantation and flow cytometry data collection. Microscopy is performed from randomised regions to avoid ROI bias.Reporting summaryFurther information on research design is available in the Nature Portfolio Reporting Summary linked to this article.
Bioengineered niches that recreate physiological extracellular matrix organisation to support long-term haematopoietic stem cells
